ID: 1017526639_1017526641

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1017526639 1017526641
Species Human (GRCh38) Human (GRCh38)
Location 6:155246975-155246997 6:155246989-155247011
Sequence CCAAATGCACCTGGATTCCTACA ATTCCTACACACACCCTTCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!