ID: 1017674015_1017674021

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1017674015 1017674021
Species Human (GRCh38) Human (GRCh38)
Location 6:156795312-156795334 6:156795329-156795351
Sequence CCGAGGAAGTGGGAAGAGAGAAT GAGAATAAGGGAAGGGAGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 10, 3: 189, 4: 1677}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!