ID: 1017738431_1017738438

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1017738431 1017738438
Species Human (GRCh38) Human (GRCh38)
Location 6:157383012-157383034 6:157383028-157383050
Sequence CCAGAAACAGTCTGGACTTCAGG CTTCAGGGATTATATCTGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!