ID: 1017751208_1017751217

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1017751208 1017751217
Species Human (GRCh38) Human (GRCh38)
Location 6:157492083-157492105 6:157492114-157492136
Sequence CCATCCAGCAGCCCTCCAGGCAG ACTGTCCCCTCTCACCGGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!