ID: 1017804198_1017804204

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1017804198 1017804204
Species Human (GRCh38) Human (GRCh38)
Location 6:157929209-157929231 6:157929231-157929253
Sequence CCTCCCTCCTTCTCCTTTGTTTG GTAGGCTTTCATTCTGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 86, 4: 917} {0: 1, 1: 0, 2: 0, 3: 19, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!