ID: 1017858049_1017858056

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1017858049 1017858056
Species Human (GRCh38) Human (GRCh38)
Location 6:158368692-158368714 6:158368712-158368734
Sequence CCCAGTTATGAAAGCAATTTCAG CAGGGTATACAGCCTGGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!