ID: 1017859143_1017859148

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1017859143 1017859148
Species Human (GRCh38) Human (GRCh38)
Location 6:158379077-158379099 6:158379104-158379126
Sequence CCGTCTGGGAGAGAGTCCAGGCT GCATAGGTGTGATGTGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 185} {0: 1, 1: 0, 2: 1, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!