ID: 1017859759_1017859762

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1017859759 1017859762
Species Human (GRCh38) Human (GRCh38)
Location 6:158384643-158384665 6:158384671-158384693
Sequence CCAAGTATTTGAATTTGTTTGAC ATTAGCCAGCTGTCTAAATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 303} {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!