ID: 1017882680_1017882686

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1017882680 1017882686
Species Human (GRCh38) Human (GRCh38)
Location 6:158572736-158572758 6:158572787-158572809
Sequence CCTGGGAGGGCGAGTGAGTTTCC CGGCAAGGCAGCGTCCGTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 365} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!