ID: 1017958300_1017958304

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1017958300 1017958304
Species Human (GRCh38) Human (GRCh38)
Location 6:159198562-159198584 6:159198575-159198597
Sequence CCTTGGCTCCCCAAGTCCAGCTG AGTCCAGCTGTGAAGTTAAATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 36, 4: 355} {0: 1, 1: 0, 2: 2, 3: 18, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!