ID: 1017962349_1017962362

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1017962349 1017962362
Species Human (GRCh38) Human (GRCh38)
Location 6:159233287-159233309 6:159233335-159233357
Sequence CCCAGAGAACCCCAAATCCACAG GTACTCCTCCCTGGCCTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 292} {0: 1, 1: 0, 2: 1, 3: 23, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!