ID: 1017965438_1017965443

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1017965438 1017965443
Species Human (GRCh38) Human (GRCh38)
Location 6:159260643-159260665 6:159260663-159260685
Sequence CCAGCCAGGTTCATCCTCTCCCT CCTGTCAACCATAAGTTGCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!