ID: 1018129763_1018129769

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1018129763 1018129769
Species Human (GRCh38) Human (GRCh38)
Location 6:160717922-160717944 6:160717959-160717981
Sequence CCTTAACATCCATCTGTGCATTC ATTCATTGTAGGGCTGGGCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!