ID: 1018132644_1018132649

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018132644 1018132649
Species Human (GRCh38) Human (GRCh38)
Location 6:160747413-160747435 6:160747430-160747452
Sequence CCCTGCTGCAGTTTCTCAGAGGT AGAGGTGCTAGGAGGGCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 207} {0: 1, 1: 0, 2: 1, 3: 18, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!