ID: 1018170450_1018170456

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1018170450 1018170456
Species Human (GRCh38) Human (GRCh38)
Location 6:161139679-161139701 6:161139706-161139728
Sequence CCGAGGCCCTGCTTCCAAGGGAA AGAGATACACAGGTGCCACCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 292} {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!