ID: 1018222909_1018222912

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1018222909 1018222912
Species Human (GRCh38) Human (GRCh38)
Location 6:161599205-161599227 6:161599223-161599245
Sequence CCATCCAAGCTTGTGGCAGATTG GATTGTTTTTTGGCAGCCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 123} {0: 1, 1: 0, 2: 1, 3: 24, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!