ID: 1018250529_1018250531

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1018250529 1018250531
Species Human (GRCh38) Human (GRCh38)
Location 6:161865424-161865446 6:161865446-161865468
Sequence CCAGGAATCGATTTTTTTTTATC CCAACTATGAAAGTCCTAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 70, 4: 616} {0: 1, 1: 35, 2: 284, 3: 606, 4: 800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!