ID: 1018252220_1018252226

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1018252220 1018252226
Species Human (GRCh38) Human (GRCh38)
Location 6:161882425-161882447 6:161882443-161882465
Sequence CCCAGCCCAGGCGGCAGCTTCCC TTCCCTCCGGGCCTTCCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 44, 4: 354} {0: 1, 1: 0, 2: 1, 3: 21, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!