ID: 1018258171_1018258174

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018258171 1018258174
Species Human (GRCh38) Human (GRCh38)
Location 6:161942876-161942898 6:161942923-161942945
Sequence CCAACAGGAGATATTTTGAGGCA AAGATGATGATTAGGGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 442} {0: 1, 1: 0, 2: 4, 3: 40, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!