|
Left Crispr |
Right Crispr |
Crispr ID |
1018289964 |
1018289970 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:162282076-162282098
|
6:162282094-162282116
|
Sequence |
CCCCTGCTGTGCAGCCCAGGTCC |
GGTCCTCACAGGCCACAGACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 8, 3: 52, 4: 410} |
{0: 1, 1: 3, 2: 202, 3: 416, 4: 827} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|