ID: 1018289966_1018289970

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1018289966 1018289970
Species Human (GRCh38) Human (GRCh38)
Location 6:162282078-162282100 6:162282094-162282116
Sequence CCTGCTGTGCAGCCCAGGTCCTC GGTCCTCACAGGCCACAGACAGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 197, 3: 536, 4: 1289} {0: 1, 1: 3, 2: 202, 3: 416, 4: 827}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!