ID: 1018343396_1018343400

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1018343396 1018343400
Species Human (GRCh38) Human (GRCh38)
Location 6:162876319-162876341 6:162876351-162876373
Sequence CCTGCTGTCCTCTAATAATACAG TGGCATCAGCAACTGCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 184} {0: 1, 1: 0, 2: 1, 3: 17, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!