ID: 1018503960_1018503966

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1018503960 1018503966
Species Human (GRCh38) Human (GRCh38)
Location 6:164443827-164443849 6:164443873-164443895
Sequence CCCACATGTAGCTGCTGTGGGCC GCAGCCCTTCAAGAGAGCATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!