ID: 1018593027_1018593032

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1018593027 1018593032
Species Human (GRCh38) Human (GRCh38)
Location 6:165448435-165448457 6:165448453-165448475
Sequence CCTTGACTGGCCTGAGCCTACTA TACTACAGTAAGGCAGCTTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!