ID: 1018599882_1018599888

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1018599882 1018599888
Species Human (GRCh38) Human (GRCh38)
Location 6:165527502-165527524 6:165527536-165527558
Sequence CCATCTCCACCAGATAACTACTC GACAGCTATTGGCCTGGTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 214, 4: 366} {0: 1, 1: 0, 2: 196, 3: 211, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!