ID: 1018610300_1018610310

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018610300 1018610310
Species Human (GRCh38) Human (GRCh38)
Location 6:165641938-165641960 6:165641985-165642007
Sequence CCACCAGCTGGAGTGGCAGAGGC TTTGACGCCCATTCGGGGCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 541} {0: 1, 1: 0, 2: 0, 3: 0, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!