ID: 1018619837_1018619839

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1018619837 1018619839
Species Human (GRCh38) Human (GRCh38)
Location 6:165719478-165719500 6:165719492-165719514
Sequence CCTGGAATTCTGTACTGGTTGAA CTGGTTGAACATGTTGTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 248} {0: 1, 1: 0, 2: 1, 3: 9, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!