ID: 1018702821_1018702828

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1018702821 1018702828
Species Human (GRCh38) Human (GRCh38)
Location 6:166440851-166440873 6:166440867-166440889
Sequence CCGCAAGTGCCGCCGGTGAGTAT TGAGTATTCTTGGGGAAAACGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 11, 3: 18, 4: 65} {0: 1, 1: 1, 2: 21, 3: 64, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!