ID: 1018722973_1018722981

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1018722973 1018722981
Species Human (GRCh38) Human (GRCh38)
Location 6:166587905-166587927 6:166587952-166587974
Sequence CCCTGCGCCCTCCTCACTCACTC TATTTTGTTTTTTATCTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 611} {0: 1, 1: 3, 2: 10, 3: 326, 4: 3487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!