ID: 1018734173_1018734177

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1018734173 1018734177
Species Human (GRCh38) Human (GRCh38)
Location 6:166675112-166675134 6:166675140-166675162
Sequence CCAGGGCTTTCTGCATAGGGATC CCCAGCTTGCCAGCAAGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 157} {0: 1, 1: 0, 2: 1, 3: 17, 4: 516}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!