ID: 1018734790_1018734797

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1018734790 1018734797
Species Human (GRCh38) Human (GRCh38)
Location 6:166679722-166679744 6:166679735-166679757
Sequence CCGGAGCCGGCTCTCTCTGCTGG TCTCTGCTGGTGGGGAGGTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 88, 3: 268, 4: 1100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!