ID: 1018753623_1018753632

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1018753623 1018753632
Species Human (GRCh38) Human (GRCh38)
Location 6:166829446-166829468 6:166829484-166829506
Sequence CCGGGTATGGTGGCGGGCGCCCG CAGAGGCTAAGGAAGGAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 21, 2: 777, 3: 6738, 4: 86879}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!