ID: 1018768440_1018768446

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1018768440 1018768446
Species Human (GRCh38) Human (GRCh38)
Location 6:166952279-166952301 6:166952317-166952339
Sequence CCAGCTTGTGGCACTTTTGTTAC CTCACACACAGCCCTCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 195} {0: 1, 1: 0, 2: 2, 3: 38, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!