ID: 1018793167_1018793171

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1018793167 1018793171
Species Human (GRCh38) Human (GRCh38)
Location 6:167165531-167165553 6:167165548-167165570
Sequence CCAGCTTCCATCAGCAAAGACAG AGACAGGAGGAAGCCAAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 366} {0: 1, 1: 0, 2: 1, 3: 31, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!