ID: 1018798352_1018798358

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1018798352 1018798358
Species Human (GRCh38) Human (GRCh38)
Location 6:167204139-167204161 6:167204154-167204176
Sequence CCCAAGCCCAGGCGTGGACGGCC GGACGGCCCTCATCTCAGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 14, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!