ID: 1018818504_1018818507

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1018818504 1018818507
Species Human (GRCh38) Human (GRCh38)
Location 6:167354557-167354579 6:167354605-167354627
Sequence CCTTCCATTGTCTGCTTCTAAAG GCAGATGCAGATAAGAAACCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 25, 4: 237} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!