ID: 1018897976_1018897991

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1018897976 1018897991
Species Human (GRCh38) Human (GRCh38)
Location 6:168034547-168034569 6:168034599-168034621
Sequence CCCTGCCTGGCTAAGACAAAACT CCTTAGGCAGGGGTGGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 641} {0: 1, 1: 0, 2: 4, 3: 65, 4: 983}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!