ID: 1018983332_1018983338

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1018983332 1018983338
Species Human (GRCh38) Human (GRCh38)
Location 6:168616767-168616789 6:168616786-168616808
Sequence CCATCCCAGAGGCATCATAAGAC AGACAGGAAGAGCAGGGACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117} {0: 1, 1: 0, 2: 11, 3: 79, 4: 972}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!