ID: 1018990869_1018990874

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1018990869 1018990874
Species Human (GRCh38) Human (GRCh38)
Location 6:168672736-168672758 6:168672772-168672794
Sequence CCAGGTTCAAAGGGTTCTCCTGC ATGTGTTTTCAGATGGAGTGAGG
Strand - +
Off-target summary {0: 4, 1: 200, 2: 7086, 3: 91169, 4: 126936} {0: 1, 1: 0, 2: 1, 3: 31, 4: 510}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!