ID: 1019056175_1019056181

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1019056175 1019056181
Species Human (GRCh38) Human (GRCh38)
Location 6:169225144-169225166 6:169225160-169225182
Sequence CCGTCCAAGTCCTCCTGGTCTGG GGTCTGGGTTGAACACAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 282} {0: 1, 1: 0, 2: 0, 3: 10, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!