ID: 1019089665_1019089667

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1019089665 1019089667
Species Human (GRCh38) Human (GRCh38)
Location 6:169518092-169518114 6:169518113-169518135
Sequence CCTATGGGTTTGCAGGCTTCAGA GACCCAATGGCTGCTCTCACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 130, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!