ID: 1019099703_1019099710

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1019099703 1019099710
Species Human (GRCh38) Human (GRCh38)
Location 6:169619470-169619492 6:169619503-169619525
Sequence CCTCAGAACATGTGCCCAAAGTG GCTTGGTTTTATACATTTTAGGG
Strand - +
Off-target summary {0: 1, 1: 50, 2: 517, 3: 853, 4: 1353} {0: 626, 1: 1297, 2: 1177, 3: 801, 4: 1103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!