ID: 1019183813_1019183818

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1019183813 1019183818
Species Human (GRCh38) Human (GRCh38)
Location 6:170209344-170209366 6:170209385-170209407
Sequence CCTGATGGGCAGGCAGGACAGAG CACAGGCACCTGCATACAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 87, 4: 1217} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!