ID: 1019340753_1019340767

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1019340753 1019340767
Species Human (GRCh38) Human (GRCh38)
Location 7:507762-507784 7:507804-507826
Sequence CCCCAGGGAGGCACACAGGACAG ATGCCAGGGGGGCTCATGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 381} {0: 1, 1: 0, 2: 1, 3: 11, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!