ID: 1019340775_1019340789

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1019340775 1019340789
Species Human (GRCh38) Human (GRCh38)
Location 7:507831-507853 7:507875-507897
Sequence CCCAGCCACACCTGGACCTGGAG CCCCTCCTTCCCTGACCCCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 89, 4: 847}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!