ID: 1019353866_1019353876

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1019353866 1019353876
Species Human (GRCh38) Human (GRCh38)
Location 7:568935-568957 7:568955-568977
Sequence CCCGCGGGGGGTGGTTCGGTCTC CTCTGGGAGGGGAGGGTTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 57, 4: 718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!