ID: 1019404419_1019404426

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1019404419 1019404426
Species Human (GRCh38) Human (GRCh38)
Location 7:876314-876336 7:876338-876360
Sequence CCACGTGTTGCCTGCGGACCCGC TCTGGGTCACGTGTTGCCTGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 4, 4: 51} {0: 2, 1: 4, 2: 2, 3: 24, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!