ID: 1019404429_1019404433

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1019404429 1019404433
Species Human (GRCh38) Human (GRCh38)
Location 7:876354-876376 7:876368-876390
Sequence CCTGCGGACCCGCCTCTGGGTCA TCTGGGTCACGTGTTGCCTGCGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 1, 3: 3, 4: 88} {0: 2, 1: 4, 2: 2, 3: 24, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!