ID: 1019417088_1019417101

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1019417088 1019417101
Species Human (GRCh38) Human (GRCh38)
Location 7:932739-932761 7:932773-932795
Sequence CCAGTGTCCCCCACCCAGGTCAG CGAAGGCGGTGAGCCCAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 39, 4: 356} {0: 1, 1: 0, 2: 1, 3: 1, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!