ID: 1019429163_1019429173

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1019429163 1019429173
Species Human (GRCh38) Human (GRCh38)
Location 7:990848-990870 7:990899-990921
Sequence CCCTCTGGAGCTCTGGAGGGTGC AATCCCTCCCAGCTGTTGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!